Frequently Asked Questions

Format


FASTQ format

Although it looks complicated (and maybe it is), the FASTQ format is easy to understand with a little decoding. Each read, representing a fragment of DNA, is encoded by 4 lines:

Line Description
1 Always begins with @ followed by the information about the read
2 The actual nucleic sequence
3 Always begins with a + and contains sometimes the same info in line 1
4 Has a string of characters which represent the quality scores associated with each base of the nucleic sequence; must have the same number of characters as line 2

So for example, the first sequence in our file is:

@03dd2268-71ef-4635-8bce-a42a0439ba9a runid=8711537cc800b6622b9d76d9483ecb373c6544e5 read=252 ch=179 start_time=2019-12-08T11:54:28Z flow_cell_id=FAL10820 protocol_group_id=la_trappe sample_id=08_12_2019
AGTAAGTAGCGAACCGGTTTCGTTTGGGTGTTTAACCGTTTTCGCATTTATCGTGAAACGCTTTCGCGTTTTCGTGCGGAAGGCGCTTCACCCAGGGCCTCTCATGCTTTGTCTTCCTGTTTATTCAGGATCGCCCAAAGCGAGAATCATACCACTAGACCACACGCCCGAATTATTGTTGCGTTAATAAGAAAAGCAAATATTTAAGATAGGAAGTGATTAAAGGGAATCTTCTACCAACAATATCCATTCAAATTCAGGCA
+
$'())#$$%#$%%'-$&$%'%#$%('+;<>>>18.?ACLJM7E:CFIMK<=@0/.4<9<&$007:,3<IIN<3%+&$(+#$%'$#$.2@401/5=49IEE=CH.20355>-@AC@:B?7;=C4419)*$$46211075.$%..#,529,''=CFF@:<?9B522.(&%%(9:3E99<BIL?:>RB--**5,3(/.-8B>F@@=?,9'36;:87+/19BAD@=8*''&''7752'$%&,5)AM<99$%;EE;BD:=9<@=9+%$

It means that the fragment named @03dd2268-71ef-4635-8bce-a42a0439ba9a (ID given in line1) corresponds to:

  • the DNA sequence AGTAAGTAGCGAACCGGTTTCGTTTGGGTGTTTAACCGTTTTCGCATTTATCGTGAAACGCTTTCGCGTTTTCGTGCGGAAGGCGCTTCACCCAGGGCCTCTCATGCTTTGTCTTCCTGTTTATTCAGGATCGCCCAAAGCGAGAATCATACCACTAGACCACACGCCCGAATTATTGTTGCGTTAATAAGAAAAGCAAATATTTAAGATAGGAAGTGATTAAAGGGAATCTTCTACCAACAATATCCATTCAAATTCAGGCA (line2)
  • this sequence has been sequenced with a quality $'())#$$%#$%%'-$&$%'%#$%('+;<>>>18.?ACLJM7E:CFIMK<=@0/.4<9<&$007:,3<IIN<3%+&$(+#$%'$#$.2@401/5=49IEE=CH.20355>-@AC@:B?7;=C4419)*$$46211075.$%..#,529,''=CFF@:<?9B522.(&%%(9:3E99<BIL?:>RB--**5,3(/.-8B>F@@=?,9'36;:87+/19BAD@=8*''&''7752'$%&,5)AM<99$%;EE;BD:=9<@=9+%$ (line 4).

But what does this quality score mean?

The quality score for each sequence is a string of characters, one for each base of the nucleotide sequence, used to characterize the probability of misidentification of each base. The score is encoded using the ASCII character table (with some historical differences):

Encoding of the quality score with ASCII characters for different Phred encoding. The ascii code sequence is shown at the top with symbols for 33 to 64, upper case letters, more symbols, and then lowercase letters. Sanger maps from 33 to 73 while solexa is shifted, starting at 59 and going to 104. Illumina 1.3 starts at 54 and goes to 104, Illumina 1.5 is shifted three scores to the right but still ends at 104. Illumina 1.8+ goes back to the Sanger except one single score wider. Illumina

So there is an ASCII character associated with each nucleotide, representing its Phred quality score, the probability of an incorrect base call:

Phred Quality Score Probability of incorrect base call Base call accuracy
10 1 in 10 90%
20 1 in 100 99%
30 1 in 1000 99.9%
40 1 in 10,000 99.99%
50 1 in 100,000 99.999%
60 1 in 1,000,000 99.9999%

Quality Scores

But what does this quality score mean?

The quality score for each sequence is a string of characters, one for each base of the nucleotide sequence, used to characterize the probability of misidentification of each base. The score is encoded using the ASCII character table (with some historical differences):

To save space, the sequencer records an ASCII character to represent scores 0-42. For example 10 corresponds to β€œ+” and 40 corresponds to β€œI”. FastQC knows how to translate this. This is often called β€œPhred” scoring.

Encoding of the quality score with ASCII characters for different Phred encoding. The ascii code sequence is shown at the top with symbols for 33 to 64, upper case letters, more symbols, and then lowercase letters. Sanger maps from 33 to 73 while solexa is shifted, starting at 59 and going to 104. Illumina 1.3 starts at 54 and goes to 104, Illumina 1.5 is shifted three scores to the right but still ends at 104. Illumina 1.8+ goes back to the Sanger except one single score wider. Illumina

So there is an ASCII character associated with each nucleotide, representing its Phred quality score, the probability of an incorrect base call:

Phred Quality Score Probability of incorrect base call Base call accuracy
10 1 in 10 90%
20 1 in 100 99%
30 1 in 1000 99.9%
40 1 in 10,000 99.99%
50 1 in 100,000 99.999%
60 1 in 1,000,000 99.9999%

What does 0-42 represent? These numbers, when plugged into a formula, tell us the probability of an error for that base. This is the formula, where Q is our quality score (0-42) and P is the probability of an error:

Q = -10 log10(P)

Using this formula, we can calculate that a quality score of 40 means only 0.00010 probability of an error!


Visualisation


Using IGV with Galaxy

You can send data from your Galaxy history to IGV for viewing as follows:

  1. Install IGV on your computer (IGV download page)
  2. Start IGV
  3. In recent versions of IGV, you will have to enable the port:
    • In IGV, go to View > Preferences > Advanced
    • Check the box Enable Port
  4. In Galaxy, expand the dataset you would like to view in IGV
    • Make sure you have set a reference genome/database correctly (dbkey) (instructions)
    • Under display in IGV, click on local



Still have questions?
Gitter Chat Support
Galaxy Help Forum