Title of the tutorial

Overview

question Questions
  • Which biological questions are addressed by the tutorial?

  • Which bioinformatics techniques are important to know for this type of data?

objectives Objectives
  • The learning objectives are the goals of the tutorial

  • They will be informed by your audience and will communicate to them and to yourself what you should focus on during the course

  • They are single sentences describing what a learner should be able to do once they have completed the tutorial

  • You can use Bloom’s Taxonomy to write effective learning objectives

requirements Requirements
time Time estimation:
Supporting Materials
last_modification Last modification: Jun 4, 2021

Introduction

General introduction about the topic and then an introduction of the tutorial (the questions and the objectives). It is nice also to have a scheme to sum up the pipeline used during the tutorial. The idea is to give to trainees insight into the content of the tutorial and the (theoretical and technical) key concepts they will learn.

You may want to cite some publications; this can be done by adding citations to the bibliography file (tutorial.bib file next to your tutorial.md file). These citations must be in bibtex format. If you have the DOI for the paper you wish to cite, you can get the corresponding bibtex entry using doi2bib.org.

With the example you will find in the tutorial.bib file, you can add a citation to this article here in your tutorial like this: {% cite Batut2018 %}. This will be rendered like this: Batut et al. 2018, and links to a bibliography section which will automatically be created at the end of the tutorial.

Please follow our tutorial to learn how to fill the Markdown

Agenda

In this tutorial, we will cover:

  1. Title for your first section
    1. Title for a subsection
  2. Hands-on Sections
    1. Get data
  3. Title of the section usually corresponding to a big step in the analysis
    1. Sub-step with Parse parameter value
    2. Sub-step with Cutadapt
    3. Sub-step with Collapse Collection
    4. Sub-step with Hifiasm
    5. Sub-step with Meryl
    6. Sub-step with GFA to FASTA
    7. Sub-step with GFA to FASTA
    8. Sub-step with Meryl
    9. Sub-step with Quast
    10. Sub-step with Purge overlaps
    11. Sub-step with Busco
    12. Sub-step with Merqury
    13. Sub-step with Map with minimap2
    14. Sub-step with GenomeScope
    15. Sub-step with Map with minimap2
    16. Sub-step with Purge overlaps
    17. Sub-step with Compute
    18. Sub-step with Compute
    19. Sub-step with Advanced Cut
    20. Sub-step with Advanced Cut
    21. Sub-step with Parse parameter value
    22. Sub-step with Parse parameter value
    23. Sub-step with Purge overlaps
    24. Sub-step with Purge haplotigs
    25. Sub-step with Purge overlaps
    26. Sub-step with Merqury
    27. Sub-step with Bionano Hybrid Scaffold
    28. Sub-step with Quast
    29. Sub-step with Busco
    30. Sub-step with Concatenate datasets
    31. Sub-step with Concatenate datasets
    32. Sub-step with Map with minimap2
    33. Sub-step with Purge overlaps
    34. Sub-step with Merqury
    35. Sub-step with Quast
    36. Sub-step with Busco
    37. Sub-step with Map with BWA-MEM
    38. Sub-step with Map with BWA-MEM
    39. Sub-step with Purge overlaps
    40. Sub-step with Map with minimap2
    41. Sub-step with bellerophon
    42. Sub-step with Purge overlaps
    43. Sub-step with bedtools BAM to BED
    44. Sub-step with Purge haplotigs
    45. Sub-step with Sort
    46. Sub-step with Purge overlaps
    47. Sub-step with SALSA
    48. Sub-step with Quast
    49. Sub-step with Merqury
    50. Sub-step with Busco
    51. Sub-step with Merqury
    52. Sub-step with Busco
    53. Sub-step with Quast
    54. Sub-step with Map with BWA-MEM
    55. Sub-step with PretextMap
    56. Sub-step with Pretext Snapshot
    57. Re-arrange

Title for your first section

Give some background about what the trainees will be doing in the section. Remember that many people reading your materials will likely be novices, so make sure to explain all the relevant concepts.

Title for a subsection

Section and subsection titles will be displayed in the tutorial index on the left side of the page, so try to make them informative and concise!

Hands-on Sections

Below are a series of hand-on boxes, one for each tool in your workflow file. Often you may wish to combine several boxes into one or make other adjustments such as breaking the tutorial into sections, we encourage you to make such changes as you see fit, this is just a starting point :)

Anywhere you find the word “TODO”, there is something that needs to be changed depending on the specifics of your tutorial.

have fun!

Get data

hands_on Hands-on: Data upload

  1. Create a new history for this tutorial
  2. Import the files from Zenodo or from the shared data library (GTN - Material -> assembly -> Title of the tutorial):

    
    

    TODO: Add the files by the ones on Zenodo here (if not added)

    TODO: Remove the useless files (if added)

    • Copy the link location
    • Open the Galaxy Upload Manager (galaxy-upload on the top-right of the tool panel)

    • Select Paste/Fetch Data
    • Paste the link into the text field

    • Press Start

    • Close the window

    • By default, Galaxy uses the URL as the name, so rename the files with a more useful name.

    Tip: Importing data from a data library

    As an alternative to uploading the data from a URL or your computer, the files may also have been made available from a shared data library:

    • Go into Shared data (top panel) then Data libraries

    • Find the correct folder (ask your instructor)

    • Select the desired files
    • Click on the To History button near the top and select as Datasets from the dropdown menu
    • In the pop-up window, select the history you want to import the files to (or create a new one)
    • Click on Import
  3. Rename the datasets
  4. Check that the datatype

    Tip: Changing the datatype

    • Click on the galaxy-pencil pencil icon for the dataset to edit its attributes
    • In the central panel, click on the galaxy-chart-select-data Datatypes tab on the top
    • Select datatypes
    • Click the Change datatype button
  5. Add to each database a tag corresponding to …

    Tip: Adding a tag

    • Click on the dataset
    • Click on galaxy-tags Edit dataset tags
    • Add a tag starting with #

      Tags starting with # will be automatically propagated to the outputs of tools using this dataset.

    • Check that the tag is appearing below the dataset name

Title of the section usually corresponding to a big step in the analysis

It comes first a description of the step: some background and some theory. Some image can be added there to support the theory explanation:

Alternative text
Figure 1: Legend of the image

The idea is to keep the theory description before quite simple to focus more on the practical part.

TODO: Consider adding a detail box to expand the theory

details More details about the theory

But to describe more details, it is possible to use the detail boxes which are expandable

A big step can have several subsections or sub steps:

Sub-step with Parse parameter value

hands_on Hands-on: Task description

  1. Parse parameter value Tool: param_value_from_file with the following parameters:
    • param-file “Input file containing parameter to parse out of”: output (Input dataset)

    TODO: Check parameter descriptions

    TODO: Consider adding a comment or tip box

    comment Comment

    A comment about the tool or something else. This box can also be in the main text

TODO: Consider adding a question to test the learners understanding of the previous exercise

question Questions

  1. Question1?
  2. Question2?

solution Solution

  1. Answer for question1
  2. Answer for question2

Sub-step with Cutadapt

hands_on Hands-on: Task description

  1. Cutadapt Tool: toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/3.4 with the following parameters:
    • “Single-end or Paired-end reads?”: Single-end
      • param-collection “FASTQ/A file”: output (Input dataset collection)
      • In “Read 1 Options”:
        • In “5’ or 3’ (Anywhere) Adapters”:
          • param-repeat “Insert 5’ or 3’ (Anywhere) Adapters”
            • “Source”: Enter custom sequence
              • “Enter custom 5’ or 3’ adapter sequence”: ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT
          • param-repeat “Insert 5’ or 3’ (Anywhere) Adapters”
            • “Source”: Enter custom sequence
              • “Enter custom 5’ or 3’ adapter sequence”: ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT
    • In “Adapter Options”:
      • “Match times”: 3
      • “Maximum error rate”: 0.1
      • “Minimum overlap length”: 35
      • “Look for adapters in the reverse complement”: True
    • In “Filter Options”:
      • “Discard Trimmed Reads: Yes

    TODO: Check parameter descriptions

    TODO: Consider adding a comment or tip box

    comment Comment

    A comment about the tool or something else. This box can also be in the main text

TODO: Consider adding a question to test the learners understanding of the previous exercise

question Questions

  1. Question1?
  2. Question2?

solution Solution

  1. Answer for question1
  2. Answer for question2

Sub-step with Collapse Collection

hands_on Hands-on: Task description

  1. Collapse Collection Tool: toolshed.g2.bx.psu.edu/repos/nml/collapse_collections/collapse_dataset/4.2 with the following parameters:
    • param-file “Collection of files to collapse into single dataset”: out1 (output of Cutadapt tool)
    • “Prepend File name”: Yes

    TODO: Check parameter descriptions

    TODO: Consider adding a comment or tip box

    comment Comment

    A comment about the tool or something else. This box can also be in the main text

TODO: Consider adding a question to test the learners understanding of the previous exercise

question Questions

  1. Question1?
  2. Question2?

solution Solution

  1. Answer for question1
  2. Answer for question2

Sub-step with Hifiasm

hands_on Hands-on: Task description

  1. Hifiasm Tool: toolshed.g2.bx.psu.edu/repos/bgruening/hifiasm/hifiasm/0.14+galaxy0 with the following parameters:
    • “Assembly mode”: Standard
      • param-file “Input reads: out1 (output of Cutadapt tool)
    • “Advanced options”: Leave default
    • “Assembly options”: Leave default
    • “Options for purging duplicates”: Specify

    TODO: Check parameter descriptions

    TODO: Consider adding a comment or tip box

    comment Comment

    A comment about the tool or something else. This box can also be in the main text

TODO: Consider adding a question to test the learners understanding of the previous exercise

question Questions

  1. Question1?
  2. Question2?

solution Solution

  1. Answer for question1
  2. Answer for question2

Sub-step with Meryl

hands_on Hands-on: Task description

  1. Meryl Tool: toolshed.g2.bx.psu.edu/repos/iuc/meryl/meryl/1.3+galaxy0 with the following parameters:
    • “Operation type selector”: Count operations
      • param-file “Input sequences”: output (output of Collapse Collection tool)
      • “K-mer size selector”: Estimate the best k-mer size
        • “Genome size”: 1050000000

    TODO: Check parameter descriptions

    TODO: Consider adding a comment or tip box

    comment Comment

    A comment about the tool or something else. This box can also be in the main text

TODO: Consider adding a question to test the learners understanding of the previous exercise

question Questions

  1. Question1?
  2. Question2?

solution Solution

  1. Answer for question1
  2. Answer for question2

Sub-step with GFA to FASTA

hands_on Hands-on: Task description

  1. GFA to FASTA Tool: toolshed.g2.bx.psu.edu/repos/iuc/gfa_to_fa/gfa_to_fa/0.1.2 with the following parameters:
    • param-file “Input GFA file”: primary_contig_graph (output of Hifiasm tool)

    TODO: Check parameter descriptions

    TODO: Consider adding a comment or tip box

    comment Comment

    A comment about the tool or something else. This box can also be in the main text

TODO: Consider adding a question to test the learners understanding of the previous exercise

question Questions

  1. Question1?
  2. Question2?

solution Solution

  1. Answer for question1
  2. Answer for question2

Sub-step with GFA to FASTA

hands_on Hands-on: Task description

  1. GFA to FASTA Tool: toolshed.g2.bx.psu.edu/repos/iuc/gfa_to_fa/gfa_to_fa/0.1.2 with the following parameters:
    • param-file “Input GFA file”: alternate_contig_graph (output of Hifiasm tool)

    TODO: Check parameter descriptions

    TODO: Consider adding a comment or tip box

    comment Comment

    A comment about the tool or something else. This box can also be in the main text

TODO: Consider adding a question to test the learners understanding of the previous exercise

question Questions

  1. Question1?
  2. Question2?

solution Solution

  1. Answer for question1
  2. Answer for question2

Sub-step with Meryl

hands_on Hands-on: Task description

  1. Meryl Tool: toolshed.g2.bx.psu.edu/repos/iuc/meryl/meryl/1.3+galaxy0 with the following parameters:
    • “Operation type selector”: Generate histogram dataset
      • param-file “Input meryldb”: read_db (output of Meryl tool)

    TODO: Check parameter descriptions

    TODO: Consider adding a comment or tip box

    comment Comment

    A comment about the tool or something else. This box can also be in the main text

TODO: Consider adding a question to test the learners understanding of the previous exercise

question Questions

  1. Question1?
  2. Question2?

solution Solution

  1. Answer for question1
  2. Answer for question2

Sub-step with Quast

hands_on Hands-on: Task description

  1. Quast Tool: toolshed.g2.bx.psu.edu/repos/iuc/quast/quast/5.0.2+galaxy1 with the following parameters:
    • “Use customized names for the input files?”: No, use dataset names
      • param-file “Contigs/scaffolds file”: out_fa (output of GFA to FASTA tool)
    • “Type of assembly”: Genome
      • “Use a reference genome?”: No
    • In “Genes”:
      • “Tool for gene prediction”: Don't predict genes

    TODO: Check parameter descriptions

    TODO: Consider adding a comment or tip box

    comment Comment

    A comment about the tool or something else. This box can also be in the main text

TODO: Consider adding a question to test the learners understanding of the previous exercise

question Questions

  1. Question1?
  2. Question2?

solution Solution

  1. Answer for question1
  2. Answer for question2

Sub-step with Purge overlaps

hands_on Hands-on: Task description

  1. Purge overlaps Tool: toolshed.g2.bx.psu.edu/repos/iuc/purge_dups/purge_dups/1.2.5+galaxy2 with the following parameters:
    • “Select the purge_dups function”: split FASTA file by 'N's
      • param-file “Base-level coverage file”: out_fa (output of GFA to FASTA tool)

    TODO: Check parameter descriptions

    TODO: Consider adding a comment or tip box

    comment Comment

    A comment about the tool or something else. This box can also be in the main text

TODO: Consider adding a question to test the learners understanding of the previous exercise

question Questions

  1. Question1?
  2. Question2?

solution Solution

  1. Answer for question1
  2. Answer for question2

Sub-step with Busco

hands_on Hands-on: Task description

  1. Busco Tool: toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.0.0+galaxy0 with the following parameters:
    • param-file “Sequences to analyse”: out_fa (output of GFA to FASTA tool)
    • “Mode”: Genome assemblies (DNA)
      • “Use Augustus instead of Metaeuk”: Use Metaeuk
    • “Lineage”: Vertebrata
    • In “Advanced Options”:
      • “Which outputs should be generated”: ``

    TODO: Check parameter descriptions

    TODO: Consider adding a comment or tip box

    comment Comment

    A comment about the tool or something else. This box can also be in the main text

TODO: Consider adding a question to test the learners understanding of the previous exercise

question Questions

  1. Question1?
  2. Question2?

solution Solution

  1. Answer for question1
  2. Answer for question2

Sub-step with Merqury

hands_on Hands-on: Task description

  1. Merqury Tool: toolshed.g2.bx.psu.edu/repos/iuc/merqury/merqury/1.3 with the following parameters:
    • “Evaluation mode”: Default mode
      • param-file “K-mer counts database”: read_db (output of Meryl tool)
      • “Number of assemblies”: One assembly (pseudo-haplotype or mixed-haplotype)
        • param-file “Genome assembly”: out_fa (output of GFA to FASTA tool)

    TODO: Check parameter descriptions

    TODO: Consider adding a comment or tip box

    comment Comment

    A comment about the tool or something else. This box can also be in the main text

TODO: Consider adding a question to test the learners understanding of the previous exercise

question Questions

  1. Question1?
  2. Question2?

solution Solution

  1. Answer for question1
  2. Answer for question2

Sub-step with Map with minimap2

hands_on Hands-on: Task description

  1. Map with minimap2 Tool: toolshed.g2.bx.psu.edu/repos/iuc/minimap2/minimap2/2.17+galaxy4 with the following parameters:
    • “Will you select a reference genome from your history or use a built-in index?”: Use a genome from history and build index
      • param-file “Use the following dataset as the reference sequence”: out_fa (output of GFA to FASTA tool)
    • “Single or Paired-end reads: Single
      • param-file “Select fastq dataset”: out1 (output of Cutadapt tool)
      • “Select a profile of preset options”: Long assembly to reference mapping (-k19 -w19 -A1 -B19 -O39,81 -E3,1 -s200 -z200 --min-occ-floor=100). Typically, the alignment will not extend to regions with 5% or higher sequence divergence. Only use this preset if the average divergence is far below 5%. (asm5)
    • In “Alignment options”:
      • “Customize spliced alignment mode?”: No, use profile setting or leave turned off
    • In “Set advanced output options”:
      • “Select an output format”: paf

    TODO: Check parameter descriptions

    TODO: Consider adding a comment or tip box

    comment Comment

    A comment about the tool or something else. This box can also be in the main text

TODO: Consider adding a question to test the learners understanding of the previous exercise

question Questions

  1. Question1?
  2. Question2?

solution Solution

  1. Answer for question1
  2. Answer for question2

Sub-step with GenomeScope

hands_on Hands-on: Task description

  1. GenomeScope Tool: toolshed.g2.bx.psu.edu/repos/iuc/genomescope/genomescope/2.0 with the following parameters:
    • param-file “Input histogram file”: read_db_hist (output of Meryl tool)
    • “Add the model parameters to your history”: Yes
    • “Output a summary of the analysis”: Yes
    • “K-mer length used to calculate k-mer spectra”: 31
    • “Create testing.tsv file with model parameters”: Yes

    TODO: Check parameter descriptions

    TODO: Consider adding a comment or tip box

    comment Comment

    A comment about the tool or something else. This box can also be in the main text

TODO: Consider adding a question to test the learners understanding of the previous exercise

question Questions

  1. Question1?
  2. Question2?

solution Solution

  1. Answer for question1
  2. Answer for question2

Sub-step with Map with minimap2

hands_on Hands-on: Task description

  1. Map with minimap2 Tool: toolshed.g2.bx.psu.edu/repos/iuc/minimap2/minimap2/2.17+galaxy4 with the following parameters:
    • “Will you select a reference genome from your history or use a built-in index?”: Use a genome from history and build index
      • param-file “Use the following dataset as the reference sequence”: split_fasta (output of Purge overlaps tool)
    • “Single or Paired-end reads: Single
      • param-file “Select fastq dataset”: split_fasta (output of Purge overlaps tool)
      • “Select a profile of preset options”: Construct a self-homology map - use same genome as query and reference (-DP -k19 -w19 -m200) (self-homology)
    • In Mapping options”:
      • “force minimap2 to always use k-mers occuring this many times or fewer”: 100
      • “minimal chaining score (matching bases minus log gap penalty)”: 40
    • In “Alignment options”:
      • “Customize spliced alignment mode?”: No, use profile setting or leave turned off
      • “Score for a sequence match”: 1
      • “Penalty for a mismatch”: 19
      • “Gap open penalties for deletions”: 39
      • “Gap open penalties for insertions”: 81
      • “Gap extension penalties; a gap of size k cost ‘-O + -Ek’. If two numbers are specified, the first is the penalty of extending a deletion and the second for extending an insertion”*: 3
      • “Gap extension penalty for extending an insertion; if left empty uses the value specified for Gap extension penalties above”: 1
      • “Z-drop threshold for truncating an alignment”: 200
    • In “Set advanced output options”:
      • “Select an output format”: paf

    TODO: Check parameter descriptions

    TODO: Consider adding a comment or tip box

    comment Comment

    A comment about the tool or something else. This box can also be in the main text

TODO: Consider adding a question to test the learners understanding of the previous exercise

question Questions

  1. Question1?
  2. Question2?

solution Solution

  1. Answer for question1
  2. Answer for question2

Sub-step with Purge overlaps

hands_on Hands-on: Task description

  1. Purge overlaps Tool: toolshed.g2.bx.psu.edu/repos/iuc/purge_dups/purge_dups/1.2.5+galaxy2 with the following parameters:
    • “Select the purge_dups function”: create read depth histogram and base-level read depth for pacbio data
      • param-file “PAF input file”: alignment_output (output of Map with minimap2 tool)

    TODO: Check parameter descriptions

    TODO: Consider adding a comment or tip box

    comment Comment

    A comment about the tool or something else. This box can also be in the main text

TODO: Consider adding a question to test the learners understanding of the previous exercise

question Questions

  1. Question1?
  2. Question2?

solution Solution

  1. Answer for question1
  2. Answer for question2

Sub-step with Compute

hands_on Hands-on: Task description

  1. Compute Tool: toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/1.6 with the following parameters:
    • “Add expression: 1.5*c3
    • param-file “as a new column to”: model_params (output of GenomeScope tool)
    • “Round result?”: Yes
    • “Input has a header line with column names?”: No

    TODO: Check parameter descriptions

    TODO: Consider adding a comment or tip box

    comment Comment

    A comment about the tool or something else. This box can also be in the main text

TODO: Consider adding a question to test the learners understanding of the previous exercise

question Questions

  1. Question1?
  2. Question2?

solution Solution

  1. Answer for question1
  2. Answer for question2

Sub-step with Compute

hands_on Hands-on: Task description

  1. Compute Tool: toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/1.6 with the following parameters:
    • “Add expression: 3*c7
    • param-file “as a new column to”: out_file1 (output of Compute tool)
    • “Round result?”: Yes
    • “Input has a header line with column names?”: No

    TODO: Check parameter descriptions

    TODO: Consider adding a comment or tip box

    comment Comment

    A comment about the tool or something else. This box can also be in the main text

TODO: Consider adding a question to test the learners understanding of the previous exercise

question Questions

  1. Question1?
  2. Question2?

solution Solution

  1. Answer for question1
  2. Answer for question2

Sub-step with Advanced Cut

hands_on Hands-on: Task description

  1. Advanced Cut Tool: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cut_tool/1.1.0 with the following parameters:
    • param-file “File to cut”: out_file1 (output of Compute tool)
    • “Cut by”: fields
      • “List of Fields”: c8

    TODO: Check parameter descriptions

    TODO: Consider adding a comment or tip box

    comment Comment

    A comment about the tool or something else. This box can also be in the main text

TODO: Consider adding a question to test the learners understanding of the previous exercise

question Questions

  1. Question1?
  2. Question2?

solution Solution

  1. Answer for question1
  2. Answer for question2

Sub-step with Advanced Cut

hands_on Hands-on: Task description

  1. Advanced Cut Tool: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cut_tool/1.1.0 with the following parameters:
    • param-file “File to cut”: out_file1 (output of Compute tool)
    • “Cut by”: fields
      • “List of Fields”: cc7

    TODO: Check parameter descriptions

    TODO: Consider adding a comment or tip box

    comment Comment

    A comment about the tool or something else. This box can also be in the main text

TODO: Consider adding a question to test the learners understanding of the previous exercise

question Questions

  1. Question1?
  2. Question2?

solution Solution

  1. Answer for question1
  2. Answer for question2

Sub-step with Parse parameter value

hands_on Hands-on: Task description

  1. Parse parameter value Tool: param_value_from_file with the following parameters:
    • param-file “Input file containing parameter to parse out of”: output (output of Advanced Cut tool)
    • “Select type of parameter to parse”: Integer

    TODO: Check parameter descriptions

    TODO: Consider adding a comment or tip box

    comment Comment

    A comment about the tool or something else. This box can also be in the main text

TODO: Consider adding a question to test the learners understanding of the previous exercise

question Questions

  1. Question1?
  2. Question2?

solution Solution

  1. Answer for question1
  2. Answer for question2

Sub-step with Parse parameter value

hands_on Hands-on: Task description

  1. Parse parameter value Tool: param_value_from_file with the following parameters:
    • param-file “Input file containing parameter to parse out of”: output (output of Advanced Cut tool)
    • “Select type of parameter to parse”: Integer

    TODO: Check parameter descriptions

    TODO: Consider adding a comment or tip box

    comment Comment

    A comment about the tool or something else. This box can also be in the main text

TODO: Consider adding a question to test the learners understanding of the previous exercise

question Questions

  1. Question1?
  2. Question2?

solution Solution

  1. Answer for question1
  2. Answer for question2

Sub-step with Purge overlaps

hands_on Hands-on: Task description

  1. Purge overlaps Tool: toolshed.g2.bx.psu.edu/repos/iuc/purge_dups/purge_dups/1.2.5+galaxy2 with the following parameters:
    • “Select the purge_dups function”: calculate coverage cutoffs
      • param-file “STAT input file”: pbcstat_stat (output of Purge overlaps tool)
      • “Transition between haploid and diploid”: {'id': 26, 'output_name': 'integer_param'}
      • “Upper bound for read depth”: {'id': 25, 'output_name': 'integer_param'}

    TODO: Check parameter descriptions

    TODO: Consider adding a comment or tip box

    comment Comment

    A comment about the tool or something else. This box can also be in the main text

TODO: Consider adding a question to test the learners understanding of the previous exercise

question Questions

  1. Question1?
  2. Question2?

solution Solution

  1. Answer for question1
  2. Answer for question2

Sub-step with Purge haplotigs

hands_on Hands-on: Task description

  1. Purge haplotigs Tool: toolshed.g2.bx.psu.edu/repos/iuc/purge_dups/purge_dups/1.2.5+galaxy0 with the following parameters:
    • “Select the purge_dups function”: purge haplotigs and overlaps for an assembly
      • param-file “PAF input file”: alignment_output (output of Map with minimap2 tool)
      • param-file “Base-level coverage file”: pbcstat_cov (output of Purge overlaps tool)
      • param-file “Cutoffs file”: calcuts_tab (output of Purge overlaps tool)
      • “Rounds of chaining”: 1 round

    TODO: Check parameter descriptions

    TODO: Consider adding a comment or tip box

    comment Comment

    A comment about the tool or something else. This box can also be in the main text

TODO: Consider adding a question to test the learners understanding of the previous exercise

question Questions

  1. Question1?
  2. Question2?

solution Solution

  1. Answer for question1
  2. Answer for question2

Sub-step with Purge overlaps

hands_on Hands-on: Task description

  1. Purge overlaps Tool: toolshed.g2.bx.psu.edu/repos/iuc/purge_dups/purge_dups/1.2.5+galaxy2 with the following parameters:
    • “Select the purge_dups function”: obtain seqeuences after purging
      • param-file “Fasta input file”: out_fa (output of GFA to FASTA tool)
      • param-file Bed input file”: purge_dups_bed (output of Purge haplotigs tool)

    TODO: Check parameter descriptions

    TODO: Consider adding a comment or tip box

    comment Comment

    A comment about the tool or something else. This box can also be in the main text

TODO: Consider adding a question to test the learners understanding of the previous exercise

question Questions

  1. Question1?
  2. Question2?

solution Solution

  1. Answer for question1
  2. Answer for question2

Sub-step with Merqury

hands_on Hands-on: Task description

  1. Merqury Tool: toolshed.g2.bx.psu.edu/repos/iuc/merqury/merqury/1.3 with the following parameters:
    • “Evaluation mode”: Default mode
      • param-file “K-mer counts database”: read_db (output of Meryl tool)
      • “Number of assemblies”: One assembly (pseudo-haplotype or mixed-haplotype)
        • param-file “Genome assembly”: get_seqs_purged (output of Purge overlaps tool)

    TODO: Check parameter descriptions

    TODO: Consider adding a comment or tip box

    comment Comment

    A comment about the tool or something else. This box can also be in the main text

TODO: Consider adding a question to test the learners understanding of the previous exercise

question Questions

  1. Question1?
  2. Question2?

solution Solution

  1. Answer for question1
  2. Answer for question2

Sub-step with Bionano Hybrid Scaffold

hands_on Hands-on: Task description

  1. Bionano Hybrid Scaffold Tool: toolshed.g2.bx.psu.edu/repos/bgruening/bionano_scaffold/bionano_scaffold/3.6.1+galaxy2 with the following parameters:
    • param-file “NGS FASTA”: get_seqs_purged (output of Purge overlaps tool)
    • param-file “BioNano CMAP”: output (Input dataset)
    • “Configuration mode”: VGP mode

    TODO: Check parameter descriptions

    TODO: Consider adding a comment or tip box

    comment Comment

    A comment about the tool or something else. This box can also be in the main text

TODO: Consider adding a question to test the learners understanding of the previous exercise

question Questions

  1. Question1?
  2. Question2?

solution Solution

  1. Answer for question1
  2. Answer for question2

Sub-step with Quast

hands_on Hands-on: Task description

  1. Quast Tool: toolshed.g2.bx.psu.edu/repos/iuc/quast/quast/5.0.2+galaxy1 with the following parameters:
    • “Use customized names for the input files?”: No, use dataset names
      • param-file “Contigs/scaffolds file”: get_seqs_purged (output of Purge overlaps tool)
    • “Type of assembly”: Genome
      • “Use a reference genome?”: No
    • In “Genes”:
      • “Tool for gene prediction”: Don't predict genes

    TODO: Check parameter descriptions

    TODO: Consider adding a comment or tip box

    comment Comment

    A comment about the tool or something else. This box can also be in the main text

TODO: Consider adding a question to test the learners understanding of the previous exercise

question Questions

  1. Question1?
  2. Question2?

solution Solution

  1. Answer for question1
  2. Answer for question2

Sub-step with Busco

hands_on Hands-on: Task description

  1. Busco Tool: toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.0.0+galaxy0 with the following parameters:
    • param-file “Sequences to analyse”: get_seqs_purged (output of Purge overlaps tool)
    • “Mode”: Genome assemblies (DNA)
      • “Use Augustus instead of Metaeuk”: Use Metaeuk
    • “Lineage”: Vertebrata
    • In “Advanced Options”:
      • “Which outputs should be generated”: ``

    TODO: Check parameter descriptions

    TODO: Consider adding a comment or tip box

    comment Comment

    A comment about the tool or something else. This box can also be in the main text

TODO: Consider adding a question to test the learners understanding of the previous exercise

question Questions

  1. Question1?
  2. Question2?

solution Solution

  1. Answer for question1
  2. Answer for question2

Sub-step with Concatenate datasets

hands_on Hands-on: Task description

  1. Concatenate datasets Tool: cat1 with the following parameters:
    • param-file “Concatenate Dataset”: get_seqs_hap (output of Purge overlaps tool)
    • In “Dataset”:
      • param-repeat “Insert Dataset”
        • param-file “Select”: out_fa (output of GFA to FASTA tool)

    TODO: Check parameter descriptions

    TODO: Consider adding a comment or tip box

    comment Comment

    A comment about the tool or something else. This box can also be in the main text

TODO: Consider adding a question to test the learners understanding of the previous exercise

question Questions

  1. Question1?
  2. Question2?

solution Solution

  1. Answer for question1
  2. Answer for question2

Sub-step with Concatenate datasets

hands_on Hands-on: Task description

  1. Concatenate datasets Tool: cat1 with the following parameters:
    • param-file “Concatenate Dataset”: ngs_contigs_scaffold_trimmed (output of Bionano Hybrid Scaffold tool)
    • In “Dataset”:
      • param-repeat “Insert Dataset”
        • param-file “Select”: ngs_contigs_not_scaffolded_trimmed (output of Bionano Hybrid Scaffold tool)

    TODO: Check parameter descriptions

    TODO: Consider adding a comment or tip box

    comment Comment

    A comment about the tool or something else. This box can also be in the main text

TODO: Consider adding a question to test the learners understanding of the previous exercise

question Questions

  1. Question1?
  2. Question2?

solution Solution

  1. Answer for question1
  2. Answer for question2

Sub-step with Map with minimap2

hands_on Hands-on: Task description

  1. Map with minimap2 Tool: toolshed.g2.bx.psu.edu/repos/iuc/minimap2/minimap2/2.17+galaxy4 with the following parameters:
    • “Will you select a reference genome from your history or use a built-in index?”: Use a genome from history and build index
      • param-file “Use the following dataset as the reference sequence”: out_file1 (output of Concatenate datasets tool)
    • “Single or Paired-end reads: Single
      • param-file “Select fastq dataset”: out1 (output of Cutadapt tool)
      • “Select a profile of preset options”: Long assembly to reference mapping (-k19 -w19 -A1 -B19 -O39,81 -E3,1 -s200 -z200 --min-occ-floor=100). Typically, the alignment will not extend to regions with 5% or higher sequence divergence. Only use this preset if the average divergence is far below 5%. (asm5)
    • In “Alignment options”:
      • “Customize spliced alignment mode?”: No, use profile setting or leave turned off
    • In “Set advanced output options”:
      • “Select an output format”: paf

    TODO: Check parameter descriptions

    TODO: Consider adding a comment or tip box

    comment Comment

    A comment about the tool or something else. This box can also be in the main text

TODO: Consider adding a question to test the learners understanding of the previous exercise

question Questions

  1. Question1?
  2. Question2?

solution Solution

  1. Answer for question1
  2. Answer for question2

Sub-step with Purge overlaps

hands_on Hands-on: Task description

  1. Purge overlaps Tool: toolshed.g2.bx.psu.edu/repos/iuc/purge_dups/purge_dups/1.2.5+galaxy2 with the following parameters:
    • “Select the purge_dups function”: split FASTA file by 'N's
      • param-file “Base-level coverage file”: out_file1 (output of Concatenate datasets tool)

    TODO: Check parameter descriptions

    TODO: Consider adding a comment or tip box

    comment Comment

    A comment about the tool or something else. This box can also be in the main text

TODO: Consider adding a question to test the learners understanding of the previous exercise

question Questions

  1. Question1?
  2. Question2?

solution Solution

  1. Answer for question1
  2. Answer for question2

Sub-step with Merqury

hands_on Hands-on: Task description

  1. Merqury Tool: toolshed.g2.bx.psu.edu/repos/iuc/merqury/merqury/1.3 with the following parameters:
    • “Evaluation mode”: Default mode
      • param-file “K-mer counts database”: read_db (output of Meryl tool)
      • “Number of assemblies”: One assembly (pseudo-haplotype or mixed-haplotype)
        • param-file “Genome assembly”: out_file1 (output of Concatenate datasets tool)

    TODO: Check parameter descriptions

    TODO: Consider adding a comment or tip box

    comment Comment

    A comment about the tool or something else. This box can also be in the main text

TODO: Consider adding a question to test the learners understanding of the previous exercise

question Questions

  1. Question1?
  2. Question2?

solution Solution

  1. Answer for question1
  2. Answer for question2

Sub-step with Quast

hands_on Hands-on: Task description

  1. Quast Tool: toolshed.g2.bx.psu.edu/repos/iuc/quast/quast/5.0.2+galaxy1 with the following parameters:
    • “Use customized names for the input files?”: No, use dataset names
      • param-file “Contigs/scaffolds file”: out_file1 (output of Concatenate datasets tool)
    • “Type of assembly”: Genome
      • “Use a reference genome?”: No
    • In “Genes”:
      • “Tool for gene prediction”: Don't predict genes

    TODO: Check parameter descriptions

    TODO: Consider adding a comment or tip box

    comment Comment

    A comment about the tool or something else. This box can also be in the main text

TODO: Consider adding a question to test the learners understanding of the previous exercise

question Questions

  1. Question1?
  2. Question2?

solution Solution

  1. Answer for question1
  2. Answer for question2

Sub-step with Busco

hands_on Hands-on: Task description

  1. Busco Tool: toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.0.0+galaxy0 with the following parameters:
    • param-file “Sequences to analyse”: out_file1 (output of Concatenate datasets tool)
    • “Mode”: Genome assemblies (DNA)
      • “Use Augustus instead of Metaeuk”: Use Metaeuk
    • “Lineage”: Vertebrata
    • In “Advanced Options”:
      • “Which outputs should be generated”: ``

    TODO: Check parameter descriptions

    TODO: Consider adding a comment or tip box

    comment Comment

    A comment about the tool or something else. This box can also be in the main text

TODO: Consider adding a question to test the learners understanding of the previous exercise

question Questions

  1. Question1?
  2. Question2?

solution Solution

  1. Answer for question1
  2. Answer for question2

Sub-step with Map with BWA-MEM

hands_on Hands-on: Task description

  1. Map with BWA-MEM Tool: toolshed.g2.bx.psu.edu/repos/devteam/bwa/bwa_mem/0.7.17.2 with the following parameters:
    • “Will you select a reference genome from your history or use a built-in index?”: Use a genome from history and build index
      • param-file “Use the following dataset as the reference sequence”: out_file1 (output of Concatenate datasets tool)
    • “Single or Paired-end reads: Single
      • param-file “Select fastq dataset”: output (Input dataset)
    • “Set read groups information?”: Do not set
    • “Select analysis mode”: 1.Simple Illumina mode
    • “BAM sorting mode”: Sort by read names (i.e., the QNAME field)

    TODO: Check parameter descriptions

    TODO: Consider adding a comment or tip box

    comment Comment

    A comment about the tool or something else. This box can also be in the main text

TODO: Consider adding a question to test the learners understanding of the previous exercise

question Questions

  1. Question1?
  2. Question2?

solution Solution

  1. Answer for question1
  2. Answer for question2

Sub-step with Map with BWA-MEM

hands_on Hands-on: Task description

  1. Map with BWA-MEM Tool: toolshed.g2.bx.psu.edu/repos/devteam/bwa/bwa_mem/0.7.17.2 with the following parameters:
    • “Will you select a reference genome from your history or use a built-in index?”: Use a genome from history and build index
      • param-file “Use the following dataset as the reference sequence”: out_file1 (output of Concatenate datasets tool)
    • “Single or Paired-end reads: Single
      • param-file “Select fastq dataset”: output (Input dataset)
    • “Set read groups information?”: Do not set
    • “Select analysis mode”: 1.Simple Illumina mode
    • “BAM sorting mode”: Sort by read names (i.e., the QNAME field)

    TODO: Check parameter descriptions

    TODO: Consider adding a comment or tip box

    comment Comment

    A comment about the tool or something else. This box can also be in the main text

TODO: Consider adding a question to test the learners understanding of the previous exercise

question Questions

  1. Question1?
  2. Question2?

solution Solution

  1. Answer for question1
  2. Answer for question2

Sub-step with Purge overlaps

hands_on Hands-on: Task description

  1. Purge overlaps Tool: toolshed.g2.bx.psu.edu/repos/iuc/purge_dups/purge_dups/1.2.5+galaxy2 with the following parameters:
    • “Select the purge_dups function”: create read depth histogram and base-level read depth for pacbio data
      • param-file “PAF input file”: alignment_output (output of Map with minimap2 tool)

    TODO: Check parameter descriptions

    TODO: Consider adding a comment or tip box

    comment Comment

    A comment about the tool or something else. This box can also be in the main text

TODO: Consider adding a question to test the learners understanding of the previous exercise

question Questions

  1. Question1?
  2. Question2?

solution Solution

  1. Answer for question1
  2. Answer for question2

Sub-step with Map with minimap2

hands_on Hands-on: Task description

  1. Map with minimap2 Tool: toolshed.g2.bx.psu.edu/repos/iuc/minimap2/minimap2/2.17+galaxy4 with the following parameters:
    • “Will you select a reference genome from your history or use a built-in index?”: Use a genome from history and build index
      • param-file “Use the following dataset as the reference sequence”: split_fasta (output of Purge overlaps tool)
    • “Single or Paired-end reads: Single
      • param-file “Select fastq dataset”: split_fasta (output of Purge overlaps tool)
      • “Select a profile of preset options”: Construct a self-homology map - use same genome as query and reference (-DP -k19 -w19 -m200) (self-homology)
    • In Mapping options”:
      • “force minimap2 to always use k-mers occuring this many times or fewer”: 100
      • “minimal chaining score (matching bases minus log gap penalty)”: 40
    • In “Alignment options”:
      • “Customize spliced alignment mode?”: No, use profile setting or leave turned off
      • “Score for a sequence match”: 1
      • “Penalty for a mismatch”: 19
      • “Gap open penalties for deletions”: 39
      • “Gap open penalties for insertions”: 81
      • “Gap extension penalties; a gap of size k cost ‘-O + -Ek’. If two numbers are specified, the first is the penalty of extending a deletion and the second for extending an insertion”*: 3
      • “Gap extension penalty for extending an insertion; if left empty uses the value specified for Gap extension penalties above”: 1
      • “Z-drop threshold for truncating an alignment”: 200
    • In “Set advanced output options”:
      • “Select an output format”: paf

    TODO: Check parameter descriptions

    TODO: Consider adding a comment or tip box

    comment Comment

    A comment about the tool or something else. This box can also be in the main text

TODO: Consider adding a question to test the learners understanding of the previous exercise

question Questions

  1. Question1?
  2. Question2?

solution Solution

  1. Answer for question1
  2. Answer for question2

Sub-step with bellerophon

hands_on Hands-on: Task description

  1. bellerophon Tool: toolshed.g2.bx.psu.edu/repos/iuc/bellerophon/bellerophon/1.0+galaxy0 with the following parameters:

    TODO: Check parameter descriptions

    TODO: Consider adding a comment or tip box

    comment Comment

    A comment about the tool or something else. This box can also be in the main text

TODO: Consider adding a question to test the learners understanding of the previous exercise

question Questions

  1. Question1?
  2. Question2?

solution Solution

  1. Answer for question1
  2. Answer for question2

Sub-step with Purge overlaps

hands_on Hands-on: Task description

  1. Purge overlaps Tool: toolshed.g2.bx.psu.edu/repos/iuc/purge_dups/purge_dups/1.2.5+galaxy2 with the following parameters:
    • “Select the purge_dups function”: calculate coverage cutoffs
      • param-file “STAT input file”: pbcstat_stat (output of Purge overlaps tool)
      • “Transition between haploid and diploid”: 31
      • “Upper bound for read depth”: 94

    TODO: Check parameter descriptions

    TODO: Consider adding a comment or tip box

    comment Comment

    A comment about the tool or something else. This box can also be in the main text

TODO: Consider adding a question to test the learners understanding of the previous exercise

question Questions

  1. Question1?
  2. Question2?

solution Solution

  1. Answer for question1
  2. Answer for question2

Sub-step with bedtools BAM to BED

hands_on Hands-on: Task description

  1. bedtools BAM to BED Tool: toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_bamtobed/2.30.0+galaxy1 with the following parameters:
    • param-file “Convert the following BAM file to BED: outfile (output of bellerophon tool)
    • “What type of BED output would you like”: Create a full, 12-column "blocked" BED file

    TODO: Check parameter descriptions

    TODO: Consider adding a comment or tip box

    comment Comment

    A comment about the tool or something else. This box can also be in the main text

TODO: Consider adding a question to test the learners understanding of the previous exercise

question Questions

  1. Question1?
  2. Question2?

solution Solution

  1. Answer for question1
  2. Answer for question2

Sub-step with Purge haplotigs

hands_on Hands-on: Task description

  1. Purge haplotigs Tool: toolshed.g2.bx.psu.edu/repos/iuc/purge_dups/purge_dups/1.2.5+galaxy0 with the following parameters:
    • “Select the purge_dups function”: purge haplotigs and overlaps for an assembly
      • param-file “PAF input file”: alignment_output (output of Map with minimap2 tool)
      • param-file “Base-level coverage file”: pbcstat_cov (output of Purge overlaps tool)
      • param-file “Cutoffs file”: calcuts_tab (output of Purge overlaps tool)
      • “Rounds of chaining”: 1 round

    TODO: Check parameter descriptions

    TODO: Consider adding a comment or tip box

    comment Comment

    A comment about the tool or something else. This box can also be in the main text

TODO: Consider adding a question to test the learners understanding of the previous exercise

question Questions

  1. Question1?
  2. Question2?

solution Solution

  1. Answer for question1
  2. Answer for question2

Sub-step with Sort

hands_on Hands-on: Task description

  1. Sort Tool: sort1 with the following parameters:
    • param-file “Sort Dataset”: output (output of bedtools BAM to BED tool)
    • “on column”: c4
    • “with flavor”: Alphabetical sort
    • “everything in”: Ascending order

    TODO: Check parameter descriptions

    TODO: Consider adding a comment or tip box

    comment Comment

    A comment about the tool or something else. This box can also be in the main text

TODO: Consider adding a question to test the learners understanding of the previous exercise

question Questions

  1. Question1?
  2. Question2?

solution Solution

  1. Answer for question1
  2. Answer for question2

Sub-step with Purge overlaps

hands_on Hands-on: Task description

  1. Purge overlaps Tool: toolshed.g2.bx.psu.edu/repos/iuc/purge_dups/purge_dups/1.2.5+galaxy2 with the following parameters:
    • “Select the purge_dups function”: obtain seqeuences after purging
      • param-file “Fasta input file”: out_file1 (output of Concatenate datasets tool)
      • param-file Bed input file”: purge_dups_bed (output of Purge haplotigs tool)

    TODO: Check parameter descriptions

    TODO: Consider adding a comment or tip box

    comment Comment

    A comment about the tool or something else. This box can also be in the main text

TODO: Consider adding a question to test the learners understanding of the previous exercise

question Questions

  1. Question1?
  2. Question2?

solution Solution

  1. Answer for question1
  2. Answer for question2

Sub-step with SALSA

hands_on Hands-on: Task description

  1. SALSA Tool: toolshed.g2.bx.psu.edu/repos/iuc/salsa/salsa/2.2+galaxy0 with the following parameters:
    • param-file “Initial assembly file”: out_file1 (output of Concatenate datasets tool)
    • param-file Bed alignment”: out_file1 (output of Sort tool)
    • “Restriction enzyme sequence(s)”: {'id': 5, 'output_name': 'text_param'}

    TODO: Check parameter descriptions

    TODO: Consider adding a comment or tip box

    comment Comment

    A comment about the tool or something else. This box can also be in the main text

TODO: Consider adding a question to test the learners understanding of the previous exercise

question Questions

  1. Question1?
  2. Question2?

solution Solution

  1. Answer for question1
  2. Answer for question2

Sub-step with Quast

hands_on Hands-on: Task description

  1. Quast Tool: toolshed.g2.bx.psu.edu/repos/iuc/quast/quast/5.0.2+galaxy1 with the following parameters:
    • “Use customized names for the input files?”: No, use dataset names
      • param-file “Contigs/scaffolds file”: get_seqs_purged (output of Purge overlaps tool)
    • “Type of assembly”: Genome
      • “Use a reference genome?”: No
    • In “Genes”:
      • “Tool for gene prediction”: Don't predict genes

    TODO: Check parameter descriptions

    TODO: Consider adding a comment or tip box

    comment Comment

    A comment about the tool or something else. This box can also be in the main text

TODO: Consider adding a question to test the learners understanding of the previous exercise

question Questions

  1. Question1?
  2. Question2?

solution Solution

  1. Answer for question1
  2. Answer for question2

Sub-step with Merqury

hands_on Hands-on: Task description

  1. Merqury Tool: toolshed.g2.bx.psu.edu/repos/iuc/merqury/merqury/1.3 with the following parameters:
    • “Evaluation mode”: Default mode
      • param-file “K-mer counts database”: read_db (output of Meryl tool)
      • “Number of assemblies”: One assembly (pseudo-haplotype or mixed-haplotype)
        • param-file “Genome assembly”: get_seqs_purged (output of Purge overlaps tool)

    TODO: Check parameter descriptions

    TODO: Consider adding a comment or tip box

    comment Comment

    A comment about the tool or something else. This box can also be in the main text

TODO: Consider adding a question to test the learners understanding of the previous exercise

question Questions

  1. Question1?
  2. Question2?

solution Solution

  1. Answer for question1
  2. Answer for question2

Sub-step with Busco

hands_on Hands-on: Task description

  1. Busco Tool: toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.0.0+galaxy0 with the following parameters:
    • param-file “Sequences to analyse”: get_seqs_purged (output of Purge overlaps tool)
    • “Mode”: Genome assemblies (DNA)
      • “Use Augustus instead of Metaeuk”: Use Metaeuk
    • “Lineage”: Vertebrata
    • In “Advanced Options”:
      • “Which outputs should be generated”: ``

    TODO: Check parameter descriptions

    TODO: Consider adding a comment or tip box

    comment Comment

    A comment about the tool or something else. This box can also be in the main text

TODO: Consider adding a question to test the learners understanding of the previous exercise

question Questions

  1. Question1?
  2. Question2?

solution Solution

  1. Answer for question1
  2. Answer for question2

Sub-step with Merqury

hands_on Hands-on: Task description

  1. Merqury Tool: toolshed.g2.bx.psu.edu/repos/iuc/merqury/merqury/1.3 with the following parameters:
    • “Evaluation mode”: Default mode
      • param-file “K-mer counts database”: read_db (output of Meryl tool)
      • “Number of assemblies”: One assembly (pseudo-haplotype or mixed-haplotype)
        • param-file “Genome assembly”: scaffolds_fasta (output of SALSA tool)

    TODO: Check parameter descriptions

    TODO: Consider adding a comment or tip box

    comment Comment

    A comment about the tool or something else. This box can also be in the main text

TODO: Consider adding a question to test the learners understanding of the previous exercise

question Questions

  1. Question1?
  2. Question2?

solution Solution

  1. Answer for question1
  2. Answer for question2

Sub-step with Busco

hands_on Hands-on: Task description

  1. Busco Tool: toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.0.0+galaxy0 with the following parameters:
    • param-file “Sequences to analyse”: scaffolds_fasta (output of SALSA tool)
    • “Mode”: Genome assemblies (DNA)
      • “Use Augustus instead of Metaeuk”: Use Metaeuk
    • “Lineage”: Vertebrata
    • In “Advanced Options”:
      • “Which outputs should be generated”: ``

    TODO: Check parameter descriptions

    TODO: Consider adding a comment or tip box

    comment Comment

    A comment about the tool or something else. This box can also be in the main text

TODO: Consider adding a question to test the learners understanding of the previous exercise

question Questions

  1. Question1?
  2. Question2?

solution Solution

  1. Answer for question1
  2. Answer for question2

Sub-step with Quast

hands_on Hands-on: Task description

  1. Quast Tool: toolshed.g2.bx.psu.edu/repos/iuc/quast/quast/5.0.2+galaxy1 with the following parameters:
    • “Use customized names for the input files?”: No, use dataset names
      • param-file “Contigs/scaffolds file”: scaffolds_fasta (output of SALSA tool)
    • “Type of assembly”: Genome
      • “Use a reference genome?”: No
    • In “Genes”:
      • “Tool for gene prediction”: Don't predict genes

    TODO: Check parameter descriptions

    TODO: Consider adding a comment or tip box

    comment Comment

    A comment about the tool or something else. This box can also be in the main text

TODO: Consider adding a question to test the learners understanding of the previous exercise

question Questions

  1. Question1?
  2. Question2?

solution Solution

  1. Answer for question1
  2. Answer for question2

Sub-step with Map with BWA-MEM

hands_on Hands-on: Task description

  1. Map with BWA-MEM Tool: toolshed.g2.bx.psu.edu/repos/devteam/bwa/bwa_mem/0.7.17.2 with the following parameters:
    • “Will you select a reference genome from your history or use a built-in index?”: Use a genome from history and build index
      • param-file “Use the following dataset as the reference sequence”: scaffolds_fasta (output of SALSA tool)
    • “Single or Paired-end reads: Paired
      • param-file “Select first set of reads: output (Input dataset)
      • param-file “Select second set of reads: output (Input dataset)
    • “Set read groups information?”: Do not set
    • “Select analysis mode”: 1.Simple Illumina mode

    TODO: Check parameter descriptions

    TODO: Consider adding a comment or tip box

    comment Comment

    A comment about the tool or something else. This box can also be in the main text

TODO: Consider adding a question to test the learners understanding of the previous exercise

question Questions

  1. Question1?
  2. Question2?

solution Solution

  1. Answer for question1
  2. Answer for question2

Sub-step with PretextMap

hands_on Hands-on: Task description

  1. PretextMap Tool: toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.1.6+galaxy0 with the following parameters:
    • param-file “Input dataset in SAM or BAM format”: bam_output (output of Map with BWA-MEM tool)
    • “Sort by”: Don't sort

    TODO: Check parameter descriptions

    TODO: Consider adding a comment or tip box

    comment Comment

    A comment about the tool or something else. This box can also be in the main text

TODO: Consider adding a question to test the learners understanding of the previous exercise

question Questions

  1. Question1?
  2. Question2?

solution Solution

  1. Answer for question1
  2. Answer for question2

Sub-step with Pretext Snapshot

hands_on Hands-on: Task description

  1. Pretext Snapshot Tool: toolshed.g2.bx.psu.edu/repos/iuc/pretext_snapshot/pretext_snapshot/0.0.3+galaxy0 with the following parameters:
    • param-file “Input Pretext map file”: pretext_map_out (output of PretextMap tool)
    • “Output image format”: png
    • “Show grid?”: Yes

    TODO: Check parameter descriptions

    TODO: Consider adding a comment or tip box

    comment Comment

    A comment about the tool or something else. This box can also be in the main text

TODO: Consider adding a question to test the learners understanding of the previous exercise

question Questions

  1. Question1?
  2. Question2?

solution Solution

  1. Answer for question1
  2. Answer for question2

Re-arrange

To create the template, each step of the workflow had its own subsection.

TODO: Re-arrange the generated subsections into sections or other subsections. Consider merging some hands-on boxes to have a meaningful flow of the analyses

Conclusion

Sum up the tutorial and the key takeaways here. We encourage adding an overview image of the pipeline used.

keypoints Key points

  • The take-home messages

  • They will appear at the end of the tutorial

Frequently Asked Questions

Have questions about this tutorial? Check out the FAQ page for the Assembly topic to see if your question is listed there. If not, please ask your question on the GTN Gitter Channel or the Galaxy Help Forum

References

  1. Batut, B., S. Hiltemann, A. Bagnacani, D. Baker, V. Bhardwaj et al., 2018 Community-Driven Data Analysis Training for Biology. Cell Systems 6: 752–758.e1. 10.1016/j.cels.2018.05.012

Feedback

Did you use this material as an instructor? Feel free to give us feedback on how it went.

Click here to load Google feedback frame

Citing this Tutorial

  1. Delphine Lariviere, Alex Ostrovsky, 2021 Title of the tutorial (Galaxy Training Materials). https://training.galaxyproject.org/archive/2021-07-01/topics/assembly/tutorials/vgp_genome_assembly/tutorial.html Online; accessed TODAY
  2. Batut et al., 2018 Community-Driven Data Analysis Training for Biology Cell Systems 10.1016/j.cels.2018.05.012

details BibTeX

@misc{assembly-vgp_genome_assembly,
    author = "Delphine Lariviere and Alex Ostrovsky",
    title = "Title of the tutorial (Galaxy Training Materials)",
    year = "2021",
    month = "06",
    day = "04"
    url = "\url{https://training.galaxyproject.org/archive/2021-07-01/topics/assembly/tutorials/vgp_genome_assembly/tutorial.html}",
    note = "[Online; accessed TODAY]"
}
@article{Batut_2018,
        doi = {10.1016/j.cels.2018.05.012},
        url = {https://doi.org/10.1016%2Fj.cels.2018.05.012},
        year = 2018,
        month = {jun},
        publisher = {Elsevier {BV}},
        volume = {6},
        number = {6},
        pages = {752--758.e1},
        author = {B{\'{e}}r{\'{e}}nice Batut and Saskia Hiltemann and Andrea Bagnacani and Dannon Baker and Vivek Bhardwaj and Clemens Blank and Anthony Bretaudeau and Loraine Brillet-Gu{\'{e}}guen and Martin {\v{C}}ech and John Chilton and Dave Clements and Olivia Doppelt-Azeroual and Anika Erxleben and Mallory Ann Freeberg and Simon Gladman and Youri Hoogstrate and Hans-Rudolf Hotz and Torsten Houwaart and Pratik Jagtap and Delphine Larivi{\`{e}}re and Gildas Le Corguill{\'{e}} and Thomas Manke and Fabien Mareuil and Fidel Ram{\'{\i}}rez and Devon Ryan and Florian Christoph Sigloch and Nicola Soranzo and Joachim Wolff and Pavankumar Videm and Markus Wolfien and Aisanjiang Wubuli and Dilmurat Yusuf and James Taylor and Rolf Backofen and Anton Nekrutenko and Björn Grüning},
        title = {Community-Driven Data Analysis Training for Biology},
        journal = {Cell Systems}
}
                    

congratulations Congratulations on successfully completing this tutorial!